Vectors Tools Study Normal (14 results)

Language: English
Published by Springer-Verlag Berlin and Heidelberg GmbH & Co. K 1989
- Hardcover
Seller: Ammareal, Morangis, FranceAmmareal
Contact seller5-star sellerCondition: Used - Fine
US$ 6.61
US$ 19.01 shippingShips from France to U.S.A.Quantity: 1 available
Hardcover. Condition: Très bon. Ancien livre de bibliothèque. Edition 1989. Ammareal reverse jusqu'à 15% du prix net de cet article à des organisations caritatives. ENGLISH DESCRIPTION Book Condition: Used, Very good. Former library book. Edition 1989. Ammareal gives back up to 15% of this item's net price to charity organizatio…ns.

- Softcover
Seller: Ria Christie Collections, Uxbridge, United KingdomRia Christie Collections
Contact seller5-star sellerCondition: New
US$ 133.07
US$ 15.98 shippingShips from United Kingdom to U.S.A.Quantity: Over 20 available
Condition: New. In.

Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation
NATO Advanced Research Workshop On "Vectors For Transfer And Expression Of Genes" (1988 : Wilsede, Germany); Dernick, Rudolf; Lother, Heinz; Heinrich-Pette-Institut Fur Experimentelle Virologie Und Immunologie; North Atlantic Treaty Organization. Scientific Affairs Division
- Softcover
Seller: Romtrade Corp., STERLING HEIGHTS, U.S.A.Romtrade Corp.
Contact seller5-star sellerCondition: New
US$ 151.21
Free ShippingShips within U.S.A.Quantity: 1 available
Condition: New. This is a Brand-new US Edition. This Item may be shipped from US or any other country as we have multiple locations worldwide.

- Softcover
Seller: Basi6 International, Irving, U.S.A.Basi6 International
Contact seller5-star sellerCondition: New
US$ 151.21
Free ShippingShips within U.S.A.Quantity: 1 available
Condition: Brand New. New. US edition. Expediting shipping for all USA and Europe orders excluding PO Box. Excellent Customer Service.

Language: English
Published by Berlin ; Heidelberg ; New York ; London ; Paris ; Tokyo : Springer, 1989
- Hardcover
Seller: Die Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein, Mannheim, GermanyDie Wortfreunde - Antiquariat Wirthwein Matthias Wirthwein
Contact seller5-star sellerCondition: Used
US$ 117.49
US$ 44.94 shippingShips from Germany to U.S.A.Quantity: 2 available
gr.-8°,OPp, gebundene Ausgabe. VIII, 475 S : graph. Darst. ; 25 cm Fast neuwertiges, ungelesenes Exemplar. Sprache: Englisch Gewicht in Gramm: 1200.

- Softcover
Seller: Books Puddle, New York, U.S.A.Books Puddle
Contact seller4-star sellerCondition: New
US$ 165.91
US$ 3.99 shippingShips within U.S.A.Quantity: 4 available
Condition: New. pp. viii + 477.

- Softcover
Seller: Books Puddle, New York, U.S.A.Books Puddle
Contact seller4-star sellerCondition: Used
US$ 175.29
US$ 3.99 shippingShips within U.S.A.Quantity: 1 available
Condition: Used. pp. 475 1st Edition.

- Softcover
Seller: Majestic Books, Hounslow, United KingdomMajestic Books
Contact seller4-star sellerCondition: Used
US$ 178.69
US$ 8.67 shippingShips from United Kingdom to U.S.A.Quantity: 1 available
Condition: Used. pp. 475.

- Softcover
Seller: Revaluation Books, Exeter, United KingdomRevaluation Books
Contact seller5-star sellerCondition: New
US$ 181.64
US$ 16.67 shippingShips from United Kingdom to U.S.A.Quantity: 2 available
Paperback. Condition: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock.

- Softcover
Seller: moluna, Greven, Germanymoluna
Contact seller5-star sellerCondition: New
US$ 140.80
US$ 56.45 shippingShips from Germany to U.S.A.Quantity: Over 20 available
Condition: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an.

- Softcover
Seller: Biblios, frankfurt am main, GermanyBiblios
Contact seller4-star sellerCondition: Used
US$ 190.82
US$ 11.46 shippingShips from Germany to U.S.A.Quantity: 1 available
Condition: Used. pp. 475.

Language: English
Published by Springer, Berlin, Springer Berlin Heidelberg, Springer 2011
- Softcover
Seller: AHA-BUCH GmbH, Einbeck, GermanyAHA-BUCH GmbH
Contact seller5-star sellerCondition: New
US$ 173.89
US$ 73.94 shippingShips from Germany to U.S.A.Quantity: 2 available
Taschenbuch. Condition: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is…triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . .

- Softcover
- Print on Demand
Seller: Majestic Books, Hounslow, United KingdomMajestic Books
Contact seller4-star sellerCondition: New
US$ 170.14
US$ 8.67 shippingShips from United Kingdom to U.S.A.Quantity: 4 available
Condition: New. Print on Demand pp. viii + 477 100 Figures.

- Softcover
- Print on Demand
Seller: Biblios, frankfurt am main, GermanyBiblios
Contact seller4-star sellerCondition: New
US$ 179.06
US$ 11.46 shippingShips from Germany to U.S.A.Quantity: 4 available
Condition: New. PRINT ON DEMAND pp. viii + 477.