Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato ASI Subseries H:, 34)
ISBN 10: 3642741991 ISBN 13: 9783642741999
Published by Springer, 2011
New
Soft cover
From
Lucky's Textbooks, Dallas, TX, U.S.A.
Seller rating 5 out of 5 stars
AbeBooks Seller since July 22, 2022
This specific item is no longer available.
About this Item
Description:
Seller Inventory # ABLIING23Mar3113020235331
Synopsis:
Using the latest techniques of molecular genetics it is now possible to study the mechanisms of cell growth and differentiation at the molecular level. Especially the application of viral vectors to visualize and analyze gene expression, the techniques of stem cell manipulation as well as various results regarding the function of oncogenes or the role of cytokines and growth factors are discussed leading to new interpretations of the mechanisms which lead to normal or abnormal cell differentiation.
"About this title" may belong to another edition of this title.
Bibliographic Details
Title: Vectors as Tools for the Study of Normal and...
Publisher: Springer
Publication Date: 2011
Binding: Soft cover
Condition: New
Top Search Results from the AbeBooks Marketplace
Seller Image
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Published by
Springer Berlin Heidelberg, 2011
ISBN 10: 3642741991
ISBN 13: 9783642741999
New
Softcover
Seller: moluna, Greven, Germany
Seller rating 4 out of 5 stars
Condition: New. Proceedings of the NATO Advanced Research Workshop on Vectors for Transfer and Expression of Genes held in Wilsede, FRG, October 21-24, 1988 on the Occasion of the 40th Anniversary of the Heinrich-Pette-Institut fuerExperimentelle Virologie u. Immunologie an. Seller Inventory # 5069486
Buy New
US$ 141.04
US$ 56.54 shipping
Ships from Germany to U.S.A.
Ships from Germany to U.S.A.
Quantity: Over 20 available
Stock Image
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Seller: Books Puddle, New York, NY, U.S.A.
Seller rating 4 out of 5 stars
Condition: New. pp. viii + 477. Seller Inventory # 2658584794
Stock Image
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Print on DemandSeller: Majestic Books, Hounslow, United Kingdom
Seller rating 4 out of 5 stars
Condition: New. Print on Demand pp. viii + 477 100 Figures. Seller Inventory # 51007749
Buy New
US$ 162.89
US$ 8.60 shipping
Ships from United Kingdom to U.S.A.
Ships from United Kingdom to U.S.A.
Quantity: 4 available
Stock Image
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Print on DemandSeller: Biblios, Frankfurt am main, HESSE, Germany
Seller rating 4 out of 5 stars
Condition: New. PRINT ON DEMAND pp. viii + 477. Seller Inventory # 1858584784
Buy New
US$ 171.69
US$ 11.48 shipping
Ships from Germany to U.S.A.
Ships from Germany to U.S.A.
Quantity: 4 available
Seller Image
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Published by
Springer, Berlin, Springer Berlin Heidelberg, Springer, 2011
ISBN 10: 3642741991
ISBN 13: 9783642741999
New
Taschenbuch
Seller: AHA-BUCH GmbH, Einbeck, Germany
Seller rating 5 out of 5 stars
Taschenbuch. Condition: Neu. Neuware - Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . . Seller Inventory # 9783642741999
Buy New
US$ 174.18
US$ 74.06 shipping
Ships from Germany to U.S.A.
Ships from Germany to U.S.A.
Quantity: 2 available
Stock Image
Vectors As Tools for the Study of Normal and Abnormal Growth and Differentiation (Nato Asi Series (Closed) / Nato Asi Subseries H: (Closed))
Seller: Revaluation Books, Exeter, United Kingdom
Seller rating 5 out of 5 stars
Paperback. Condition: Brand New. reprint edition. 485 pages. 9.53x1.11x6.69 inches. In Stock. Seller Inventory # x-3642741991
Buy New
US$ 180.91
US$ 16.54 shipping
Ships from United Kingdom to U.S.A.
Ships from United Kingdom to U.S.A.
Quantity: 2 available